Влияние звёздчатых клеток печени на фенотип мезенхимных стволовых клеток крысы in vitro 03. 03. 04 клеточная биология, цитология, ги - shikardos.ru o_O
Главная
Поиск по ключевым словам:
страница 1
Похожие работы
Влияние звёздчатых клеток печени на фенотип мезенхимных стволовых клеток крысы in - страница №1/1


На правах рукописи



Шафигуллина Айгуль Касыймовна


Влияние звёздчатых клеток печени на фенотип мезенхимных стволовых клеток крысы in vitro
03.03.04 – клеточная биология, цитология, гистология


А В Т О Р Е Ф Е Р А Т

диссертации на соискание учёной степени

кандидата медицинских наук

Казань – 2013


Работа выполнена в ГБОУ ВПО «Казанский государственный медицинский университет» Министерства здравоохранения Российской Федерации


Научный руководитель доктор медицинских наук, доцент

Гумерова Аниса Азатовна

Официальные оппоненты:

Валиуллин Виктор Владимирович – доктор биологических наук, профессор кафедры гистологии, цитологии и эмбриологии ГБОУ ВПО «Казанский государственный медицинский университет» Министерства здравоохранения Российской Федерации (г. Казань).

Онищенко Нина Андреевна – доктор медицинских наук, профессор, заведующая лабораторией клеточных технологий ФГБУ ФНЦ трансплантологии и искусственных органов им. академика В.И. Шумакова Минздрава России (г. Москва).

Ведущая организация: ГБОУ ВПО «Российский национальный исследовательский медицинский университет имени Н.И. Пирогова» Минздрава России (г. Москва)
Защита диссертации состоится «___» _______________ 2013 г. в «___» часов на заседании диссертационного совета Д 208.034.01 при ГБОУ ВПО «Казанский государственный медицинский университет» Минздрава России (г. Казань).
С диссертацией можно ознакомиться в научной библиотеке ГБОУ ВПО «Казанский государственный медицинский университет» Минздрава России (420012, Казань, ул. Бутлерова, 49, корпус Б).
Автореферат разослан «___» ________________ 2013 г.
Учёный секретарь

диссертационного совета,

доктор медицинских наук, профессор Зубаирова Л.Д.

общая характеристика работы

Актуальность

Дифференцировка потомков стволовых клеток в различные клеточные типы происходит в определённых условиях микроокружения – при наличии контактов с популяцией непаренхиматозных клеток и под воздействием факторов роста (Zhang, 2003). Процесс дифференцировки прогениторных клеток в гепатоциты не является исключением. Наиболее изученными факторами роста, которые влияют на дифференцировку предшественников гепатоцитов, являются фактор роста гепатоцитов (HGF) и фактор роста фибробластов-4 (FGF4). Одним из источников данных факторов роста в печени является популяция непаренхиматозных клеток печени – звёздчатые клетки печени (ЗКП), которые находятся в перисинусоидальном пространстве в непосредственном контакте с гепатоцитами и вырабатывают факторы роста, необходимые для пролиферации и дифференцировки последних (Friedman, 2008). По мнению некоторых авторов, сами ЗКП, в пределах печёночной дольки и ацинуса, располагаются в нише стволовых клеток ( Kordes, 2009).

Согласно данным литературы, а также данным, ранее полученным нашим коллективом, ЗКП играют ключевую роль в процессе фетального печёночного гемопоэза и дифференцировки гепатоцитов и холангиоцитов в ходе пренатального развития печени (Vassy et al., 1993; Kiassov et al., 1995; Киясов и др., 1997; Гумерова и др., 2007). Более того, именно эти клетки являются важнейшим участником восстановления массы клеток паренхимы в ходе регенерации печени как за счёт вырабатываемых ими макромолекул межклеточного матрикса и его ремоделирования (Kim et al., 1997), так и за счёт продукции вышеупомянутых факторов роста (Friedman, 2008).

Если ЗКП необходимы для процессов фетального кроветворения в печени, а также дифференцировке гепатоцитов и холангиоцитов, то способны ли они создавать микроокружение для потомков стволовых клеток и, в частности, внепечёночных стволовых клеток? Ответ на этот вопрос можно получить, работая уже с известным клеточным типом – мезенхимными стволовыми клетками (МСК) костного мозга. Выбор популяции МСК обусловлен их доступностью с точки зрения методов выделения, хорошей выживаемостью и неприхотливостью в условиях in vitro, возможностью трансплантации аутологичных клеток, а значит, снятием множества законодательных, этических и религиозных вопросов по их применению в клинике. Впервые МСК были описаны Фриденштейном ещё в 70-х годах XX века (Friedenstein et al., 1974). С тех пор ведутся активные исследованиям свойств МСК, пластичности и возможности их применения в клинической практике. На сегодняшний день известно, что МСК способны продуцировать ряд факторов роста, цитокинов и сигнальных молекул, которые подавляют иммунный ответ, снижают апоптоз гепатоцитов и стимулируют их пролиферацию и функциональную активность, приводят к регрессу фиброза печени, (Zhou et al., 2009). Определённые успехи достигнуты в стимулировании направленной дифференцировки МСК в гепатоцитоподобные клетки в условиях in vitro (Prockop, 1997; Schwartz, 2002; Zhang, Fang, 2205; Ishikawa et al., 2006). Наиболее интересным среди исследований, посвящённых получению функционально активных гепатоцитов из МСК, является работа Снайкерс (Snykers et al., 2006), в которой к культуре МСК костного мозга были добавлены рекомбинантные факторы роста HGF и FGF4 в той последовательности, в которой эти факторы воздействуют на прогениторные клетки печени в ходе её онтогенеза (McLin, Zorn, 2006). Работ же, в которых проводилось бы изучение влияния естественных факторов роста или межклеточных контактов с непаренхиматозными клетками печени на гепатоцитарную дифференцировку МСК, на сегодняшний день нет. Более того, необходимо выяснить, что же важнее для дифференцировки прогениторных клеток в гепатоциты: растворимые факторы роста, непосредственные межклеточные контакты либо их комплексное воздействие.

Исходя из этого, целью нашей работы стало изучение влияния ЗКП как фактора микроокружения на изменения фенотипа культуры МСК костного мозга и их потомков в условиях in vitro у крысы.

Задачи:


1. Сравнить методы выделения звёздчатых клеток из печени крысы: метод выделения по Сеглену и метод коллагеназно-проназной перфузии печени с последующим разделением клеток в градиенте плотности гистоденза.

2. Изучить влияние рекомбинантных факторов роста FGF4 и HGF на фенотип мезенхимных стволовых клеток и звёздчатых клеток печени крысы in vitro.

3. Изучить влияние факторов роста, синтезируемых звёздчатыми клетками печени, на фенотип мезенхимных стволовых клеток крысы при различных вариантах культивирования:

а) в среде, переработанной звёздчатыми клетками печени;

б) при совместном культивировании мезенхимных стволовых клеток и звёздчатых клеток печени, разделённых полупроницаемой мембраной;

4. Изучить фенотип звёздчатых клеток печени и мезенхимных стволовых клеток при совместном культивировании.

5. Установить возможность слияния мезенхимных стволовых клеток и звёздчатых клеток печени при совместном культивировании.

Достоверность полученных данных

Достоверность полученных данных достигнута использованием достаточного количества образцов для исследования, конкретной постановкой и решением поставленных задач с использованием статистического метода. Достоверность различий между результатами оценивали по t-критерию Стьюдента.



Научная новизна

В диссертации впервые было проведено сравнение двух методов выделения ЗКП из печени крысы. Согласно полученным результатам, метод коллагеназно-проназной перфузии с последующим разделением клеток в градиенте плотности гистоденза является наиболее эффективным по сравнению с методом Сеглена по жизнеспособности (90%) и чистоте культуры (99,5%) ЗКП.

В ходе работы были впервые выполнены различные варианты культивирования МСК и ЗКП. На основании полученных данных установлено, что ЗКП способны создавать микроокружение для дифференцировки МСК в клетки с фенотипом гепатоцитов в условиях in vitro. Кроме того, было продемонстрировано, что важной составляющей микроокружения является секреция ЗКП факторов роста, индуцирующих появление в фенотипе культуры МСК экспрессии α-фетопротеина (α-ФП) и цитокератинов 18 и 19 (ЦК18 и ЦК19).

Для разграничения двух клеточных популяций при совместном культивировании ЗКП и МСК нами было впервые проведено их предварительное витальное мечение флуоресцентными метками. Благодаря этому было установлено, что появление в фенотипе МСК несвойственных им эпителиальных маркёров обусловлено не слиянием клеток, а действием сложного комплекса паракринных и контактных межклеточных взаимодействий.



Теоретическая и практическая ценность работы. Проведённое исследование имеет несомненный теоретический интерес, поскольку раскрывает ряд механизмов межклеточных взаимодействий, лежащих в основе дифференцировки потомков МСК костного мозга в гепатоциты. Полученные результаты способствуют выявлению новых данных о роли факторов роста, секретируемых ЗКП, а также о значении межклеточных контактов в создании микроокружения для прогениторных клеток, в том числе для стволовых клеток мезенхимного происхождения. В ходе исследования было показано, что появление в фенотипе МСК несвойственных им эпителиальных маркёров в виде ЦК18, ЦК19 и α-ФП может происходить под влиянием факторов роста HGF и FGF4, рекомбинантных или синтезируемых ЗКП. Однако для более устойчивой дифференцировки МСК в клетки с фенотипом гепатобластов необходимо создать условия, приближенные к естественным, поэтому оптимальным вариантом является совместное культивирование МСК и ЗКП, при котором происходит воздействие на МСК как межклеточных контактов с ЗКП, так и синтезируемых ими растворимых факторов.

Помимо теоретического интереса, проведённые исследования имеют и практическую ценность, так как в ходе выполнения работы было проведено сравнение двух методов выделения ЗКП. Согласно полученным результатам, метод Сеглена по ассоциированному выделению ЗКП и гепатоцитов является менее затратным в финансовом плане, более простым в исполнении, однако более высокие показатели жизнеспособности ЗКП (90%) и чистоты культуры (99,5%) были получены при выделении клеток методом коллагеназно-проназной перфузии печени с последующим разделением клеток в градиенте плотности гистоденза. Также практический интерес может представлять предварительное витальное мечение клеток флуоресцентными метками перед посевом на культуральную чашку, что позволяет отслеживать рост и организацию клеток при совместном культивировании ЗКП и МСК. Мечение клеток позволило установить, что изменения фенотипа МСК при совместном культивировании МСК с ЗКП происходят не путём слияния клеток двух популяций, а путём их трансдифференцировки в гепатоцитарном направлении.

Результаты исследования позволяют по-новому взглянуть на функции ЗКП и рассматривать их как важный компонент микроокружения, необходимый для гепатоцитарной дифференцировки потомков стволовых клеток in vitro, что подтверждает их роль в данном процессе, установленную ранее при изучении онтогенеза и регенерации печени.

Полученные сведения могут быть использованы для дальнейшего изучения взаимодействия различных клеточных типов в процессе регенерации печени, а также могут быть рекомендованы для лабораторной практики и использованы в учебном процессе.



Основное положение, выносимое на защиту. Звёздчатые клетки печени способны создавать микроокружение, которое обеспечивает изменение фенотипа мезенхимных стволовых клеток с мезенхимного на эпителиальный, в частности, потомки мезенхимных стволовых клеток начинают экспрессировать цитокератины 18 и 19 и α-фетопротеин.

Апробация работы состоялась на совместном научном заседании сотрудников кафедр нормальной анатомии, биологии, гистологии, цитологии и эмбриологии Казанского государственного медицинского университета (23 мая 2013 года).

Результаты исследований доложены и обсуждены на Всероссийской научно-практической конференции с международным участием «Актуальные проблемы современной науки и образования. Биологические науки», г. Уфа (2010), IV Всероссийской научно-практической конференции «Молодые ученые в медицине», г. Казань (2010), IV Всероссийском симпозиуме с международным участием «Актуальные вопросы тканевой и клеточной трансплантологии», г. Санкт-Петербург (2010), 2-м Международном конгрессе студентов-медиков, г. Кошице, Словакия (2010), IV Международном конгрессе по гастроэнтерологии, г. Фрайбург, Германия (2010), III Международном симпозиуме «Актуальные вопросы клеточных технологий», г. Москва (2010), VI Международной (XV всероссийской) Пироговской научной медицинской конференции студентов и молодых ученых, г. Москва (2011), XVI Всероссийской научно-практической конференции «Молодые ученые в медицине», г. Казань (2011), Международной научной конференции студентов и молодых ученых, посвящённой 135-летию М.Д. Стражеска, г. Одесса, Украина (2011), 4-й Международной конференции молодых учёных «Молекулярная биология: достижения и перспективы», г. Киев, Украина (2011), 22-й Европейской конференции, г. Берлин, Германия (2011), II Международной научно-практической конференции «Достижения, инновационные направления, перспективы развития и проблемы современной медицинской науки, генетики и биотехнологий», г. Екатеринбург (2011), XVII Всероссийской научно-практической конференции «Молодые ученые в медицине», г. Казань (2012), научно-практической конференции с международным участием, посвящённой 155-летию со дня рождения В.В. Подвысоцкого, г. Одесса, Украина (2012), 47-й Ежегодной встрече Европейской Ассоциации по Изучению Печени, г. Барселона, Испания (2012), 20-й Международной гепатологической неделе, г. Амстердам, Нидерланды (2012), XVIII Всероссийской научно-практической конференции «Молодые ученые в медицине», г. Казань (2013).



Публикации результатов исследования. По материалам диссертации опубликовано 30 работ (1 монография, 4 статьи в рецензируемых журналах, рекомендованных Высшей аттестационной комиссией для публикации результатов научных исследований, 25 тезисов на Всероссийских и Международных конференциях). Общий объём публикаций –11,31 условно печатных листа, в т.ч. авторский вклад – 8,48 условно печатных листа.

Личное участие диссертанта. Приведённые в работе данные получены при личном участии соискателя на всех этапах работы, включая составление плана исследования, постановку задач, выбор методов исследования, проведение экспериментов, забор материала для исследования и его обработку, анализ экспериментальных данных. Автор провёл подбор и анализ литературы, определил и применил наиболее адекватные условия проведения экспериментов, методы, позволяющие решить поставленные задачи. Теоретическое обобщение результатов исследования, их анализ и оформление, публикации результатов исследования, формулирование выводов и рекомендаций также проведены лично диссертантом.

Внедрение результатов исследования. В ходе проведения данного исследования были модифицированы некоторые методы иммуноцитохимического выявления антигенов и эти модификации внедрены в практическую работу кафедры нормальной анатомии, гистологии, цитологии и эмбриологии, а также в работу Центральной научно-исследовательской лаборатории КГМУ, отдела генных и клеточных технологий НОЦ фармацевтики КФУ.

Материалы диссертации включены в лекционные курсы для студентов кафедр гистологии, нормальной анатомии.



Объём и структура диссертации. Работа изложена на 142 страницах машинописного текста и состоит из введения, обзора литературы, описания материалов и методов исследования, результатов собственных исследований и их обсуждения, заключения, выводов, практических рекомендаций и указателя литературы, включающего 258 источников: 8 отечественных и 250 иностранных. Диссертация содержит 39 рисунков и 7 таблиц.

Работа выполнена при финансовой поддержке РФФИ (грант 09-04-97013-р_поволжье_а) и ФЦП (грант № 14.740.11.0457).


СОДЕРЖАНИЕ РАБОТЫ

Материалы и методы исследования. Исследование было проведено на 28 белых беспородных крысах-самцах рода Вистар весом 250-300 г, находящихся на стандартном рационе вивария и имеющих свободный доступ к воде. Проведение исследований одобрено Республиканским комитетом по Этическим вопросам при проведении клинических испытаний-исследований лекарственных средств при Министерстве здравоохранения Республики Татарстан (протокол №3 от 21.03.2011).

При выполнении работы были использованы иммуноцитохимические, молекулярно-биологические методы, такие как выделение РНК, реакция обратной транскрипции и полимеразная цепная реакция в режиме реального времени, электрофорез ДНК в агарозном геле, а также различные методы выделения и культивирования клеток.

Выделение ЗКП1 было проведено двумя методами: методом коллагеназно-проназной перфузии печени с последующим разделением клеток в градиенте плотности гистоденза (Knook, 1982) и методом Сеглена для ассоциированного выделения гепатоцитов и ЗКП ( Neufeld, 1997). МСК были выделены из костного мозга путём селективной адгезии к пластику. Морфологию и рост ЗКП и МСК оценивали с помощью фазово-контрастной микроскопии. Для исследования фенотипа клетки были рассеяны на покровные стёкла в 24-луночные планшеты по 250 тысяч клеток на лунку.

Для исследования изолированного влияния каждого из компонентов микроокружения было проведено культивирование клеток в различных моделях. Модель 1 – культивирование МСК и ЗКП в питательной среде с последовательным добавлением рекомбинантных факторов роста FGF4 и HGF (Snykers et al., 2006). Следующие два варианта культивирования моделируют изолированное действие паракринных факторов ЗКП на фенотип МСК (модель 2 – культивирование МСК в среде, в которой предварительно культивировали ЗКП, модель 3 – культивирование ЗКП и МСК, разделённых полупроницаемой мембраной в системе внутрилуночных вставок, исключающей формирование межклеточных контактов между разными популяциями клеток). Модель 4 – совместное культивирование ЗКП и МСК для отражения комплексного воздействия обоих компонентов микроокружения: растворимых факторов и межклеточных контактов. Для отслеживания ЗКП и МСК при совместном культивировании, а также для проверки гипотезы о слиянии клеток в процессе гепатоцитарной дифференцировки, клетки разных популяций были мечены мембранными витальными флуоресцентными метками: ЗКП – красными (PKH26) и МСК – зелёными (PKH67) (Sigma) согласно протоколу производителя. В случае слияния клетки приобрели бы жёлто-оранжевую флуоресценцию, что мы наблюдали в ходе работы над другим нашим проектом по изучению межклеточного взаимодействия МСК третьего моляра человека с опухолевыми клетками SH-SY5Y нейробластомы человека (Rizvanov et al., 2010).

Морфологические признаки клеток оценивали методами фазово-контрастной и флуоресцентной микроскопии на микроскопе DFC420 (Leica). Изучение фенотипа клеток во всех моделях было проведено путём иммуноциохимического окрашивания культур с антителами к десмину (клон D33, Dako), α-гладкомышечному актину (1А4, Dako), Bcl-2 (124, Dako), PCNA (PC10, Dako), ESA (VU-1D9, Dako), ЦК18 (DC10, Dako), ЦК19 (BA17, Dako), C-met (8F11, Novocastra), α-ФП (C3, Novocastra), HSA (ОСН1Е5, Novocastra), C-kit (T595, Novocastra). Иммуноцитохимическое окрашивание было выполнено стрептавидин-биотиновым методом с применением амплифицирующей системы CSA для антител к C-kit (CD117) и методом меченых полимеров для всех остальных антител с использованием коммерческих визуализационных систем тех же производителей.

Оценка результатов иммуноцитохимического окрашивания в разных моделях культивирования была проведна полуколичественным методом и для наглядности результаты были внесены в таблицы, при этом «+» – позитивное окрашивание в единичных клетках, «++» – позитивное окрашивание 50-70% клеток, «+++» – интенсивное позитивное окрашивание всех клеток, «-» – отсутствие экспрессии исследуемого маркёра.

Для подтверждения фенотипа ЗКП и подтверждения экспрессии ими ЦК19 были поставлены ПЦР на гены сосудистой молекулы клеточной адгезии VCAM и ЦК19 соответственно2. Для этого была выделена общая РНК набором «High Pure RNA Isolation Kit» (Roche) и поставлена реакция обратной транскрипции для синтеза кДНК. Для анализа экспрессии гена ЦК19 была поставлена ПЦР со специфичными праймерами (rЦK19-for – TCGCCTCGCCTCCTACTT, rЦK19-rev – GCTCCTCAGGGCAGTAATT). Экспрессия гена ЦК19 была проанализирована путём электрофореза ДНК в 1,5% агарозном геле3 согласно стандартной методике (Маниатис, 1984). Для оценки экспрессии гена VCAM была поставлена ПЦР в режиме реального времени по технологии TaqMan со специально синтезированными праймерами и пробой (rVCAM1-TMprobe – CGGCATCCTGCAGCTGTGCCT, rVCAM1-TMfor – GGCTCGTACACCATCCGC, rVCAM1-TMrev – CGGTTTTCGATTCACACTCGT). Количественный анализ уровня экспрессии был проведён путём построения стандартной прямой на основе серийного разведения кДНК. Реакции ПЦР были выполнены в дубликатах. Статистический анализ был проведён в программе Microsoft Excel 2002.

Результаты исследования и их обсуждение

На начальном этапе был проведён сравнительный анализ двух различных методов выделения ЗКП из печени крыс. При этом было установлено, что метод коллагеназно-проназной перфузии печени с последующим разделением клеток в градиенте плотности гистоденза является более эффективным по сравнению с методом Сеглена по жизнеспособности (90%) и чистоте культуры (99,5%) ЗКП.

Подтверждением фенотипа ЗКП послужили однородность популяции, наличие аутофлуоресценции цитоплазматических жировых включений ЗКП в течение первой недели культивирования, экспрессия специфичного для ЗКП маркёров десмина и VCAM во всех клетках (рис. 1).

Рис. 1. Результаты ПЦР в режиме реального времени на ген VCAM. МСК р0 – МСК костного мозга нулевого пассажа; ЗКП р0 – ЗКП нулевого пассажа (свежевыделенные); ЗКП р4 – ЗКП четвёртого пассажа (р < 0,05).


Наличие в фенотипе ЗКП экспрессии маркёров мезенхимных (виментина) и эпителиальных (ЦК18 и ЦК19) клеток является причиной дискуссий о происхождении ЗКП. Также нет однозначного мнения о возможной принадлежности ЗКП к стволовым клеткам печени. В пользу стволовости ЗКП свидетельствуют ряд признаков, таких как экспрессия некоторых маркёров стволовых клеток – CD133 (Kordes et al., 2007), Bcl-2 (Гумерова и др., 2007), C-kit (Гумерова и др., 2007), Thy-1 (Baba et al., 2004), а также сохранение жизнеспособности клеток в культуре, формирование колоний и высокая пролиферативная активность. В настоящей работе установлено появление в фенотипе ЗКП на 4-й неделе культивирования в стандартных условиях одного из главных маркёров гепатобластов α-ФП, что также было описано другими авторами (Nava et al., 2005) и свидетельствует о возможности спонтанной дифференцировки ЗКП в клетки с фенотипом гепатобластов, и подтверждает, таким образом, возможность отнесения их к региональным стволовым клеткам печени. Маркёра зрелых гепатоцитов HSA в культуре ЗКП обнаружено не было. Вероятно, для приобретения ЗКП свойств и фенотипа высоко специализированных гепатоцитов необходимо дополнительное стимулирующее внешнее воздействие.

Подобным внешним воздействием может быть добавление в культуру ЗКП факторов роста. Рекомбинантные факторы роста HGF, FGF4, ITS и Dex добавляли последовательно, имитируя динамику их действия в онтогенезе печени. В результате ЗКП приобретали морфологию, характерную для гепатоцитов, а в фенотипе клеток была отмечена экспрессия маркёров, свойственных гепатобластам (ЦК18 и α-ФП), и это происходило на более ранних сроках (14-е сутки) по сравнению с культивированием ЗКП в стандартных условиях (21-е сутки). Примечательно, что в фенотипе ЗКП был выявлен маркёр зрелых гепатоцитов HSA. Исходя из полученных данных можно сделать заключение, что данные факторы роста индуцировали рост и дифференцировку ЗКП в гепатоцитарном направлении.

Индукция гепатоцитарной дифферецировки была прослежена также при культивировании МСК костного мозга с рекомбинантными факторами роста HGF, FGF4, ITS и Dex. При этом происходила мезенхимно-эпителиальная трансдифференцировка (МЭТ) МСК с приобретением фенотипических признаков гепатоцитов. Среди культивируемых клеток, также как и при культивировании ЗКП в тех же условиях, были выявлены ЦК19+/ЦК18+/α-ФП+ клетки (9-е сутки), однако HSA+ клеток обнаружено не было. При культивировании же МСК в стандартных условиях гепатоцитарных маркёров обнаружено не было, а цитокератины экспрессировались транзиторно. Таким образом, при воздействии на клетки рекомбинантных факторов роста МСК способны дифференцироваться в клетки с фенотипом гепатобластов. Возможно, растворимые факторы являются одним из необходимых компонентов микроокружения, однако добавления HGF, FGF4, ITS и Dex к культуре МСК оказалось недостаточным для их полноценной дифференцировки в гепатоциты.

Поскольку ЗКП являются основным источником данных факторов роста в печени, то закономерно предположить, что среда, в которой росли ЗКП и в которую они продуцировали свои факторы роста, также может запустить процесс гепатоцитарной дифференцировки. Для проверки этой гипотезы было проведено культивирование МСК в питательной среде ЗКП. Изменения в фенотипе МСК, культивированных в среде ЗКП, были очень похожи на изменения в фенотипе МСК, культивированных с факторами роста. Так, на ранних сроках происходило повышение количества МСК, приобретение клетками компактной полигональной морфологии эпителиальных клеток, а также МЭТ и появление в фенотипе МСК маркёра гепатобластов α-ФП. Отличия в данных двух группах заключались в сроках изменений фенотипа: при культивировании МСК с рекомбинантными факторами роста изменения были выявлены на 2 недели раньше, что, вероятно, связано с добавлением к клеткам более высоких концентраций факторов роста, нежели концентраций факторов роста, содержащихся в среде, в которой росли ЗКП in vitro. Однако интересным является появление среди МСК, культивированных в питательной среде ЗКП, единичных HSA+ клеток, что означает, что культивирование в среде ЗКП может привести к дифференцировке МСК в гепатоцитоподобные клетки (таблица 1). Возможно, данный факт связан с тем, что спектр факторов роста и цитокинов ЗКП включает в себя не только HGF и FGF4, которые были добавлены к культуре МСК в виде очищенных рекомбинантных белков, но также другие, не менее важные, биологически активные вещества, такие как фактор роста стволовых клеток (Stem Cell Factor, SCF) (Fujio, 1994), эпидермальный фактор роста (Epidermal Growth Factor, EGF) (Bachem et al., 1992; Mullhaupt et al., 1994) и т.д. Таким образом, дифференцировка МСК в гепатоцитоподобные клетки возможна при воздействии только факторов роста, однако предпочтительным является культивирование МСК в среде, в которой предварительно культивировали ЗКП, нежели культивирование с очищенными рекомбинантными факторами роста. Можно также сделать вывод, что факторы роста, продуцируемые ЗКП, являются важной составляющей микроокружения для стволовых/прогениторных клеток в печени.



Таблица 1

Фенотип МСК при стандартном культивировании и совместном культивировании с ЗКП

Маркёр

Монокультура МСК

МСК+среда ЗКП

Совместная культура МСК+ЗКП

14-й день

21-й день

28-й день

14-й день

21-й день

28-й день

14-й день

21-й день

28-й день

α-ГMA

+++

++

+

+

++

+/-

++

++

+

Десмин

-

+/-

++

+/-

+

++

+/-

+

++

CD117 (C-kit)

+++

+++

+++

++

+

+/-

++

++

+

Bcl-2

+

+/-

-

-

+/-

+/-

++

++

++

ESA

-

-

+/-

-

+/-

+

-

+

+/-

ЦК18

+/-

+++

+

-

+/-

+/-

+

++

+/-

ЦК19

+/-

+++

+

++

+/-

+/-

++

++

+/-

α-ФП

-

-

-

-

-

+/-

-

+

+

HSA

-

-

-

-

-

+/-

-

-

-

Влияние паракринной регуляции со стороны ЗКП на фенотип МСК было также проверено в другой модели – при культивировании ЗКП и МСК в системе внутрилуночных вставок. В данном случае обе популяции клеток культивировали совместно в одной лунке, но клетки были разделены полупроницаемой мембраной, что исключало формирование непосредственных межклеточных контактов. Поскольку ЗКП и МСК растут в общей по составу питательной среде, то влияние паракринных факторов осуществляется не только со стороны ЗКП на МСК, но и со стороны МСК на ЗКП. Последнее, вероятно, определило главное отличие результатов данной модели культивирования от результатов культивирования МСК в питательной среде ЗКП: HSA+ клеток при культивировании на вставках обнаружено не было. Возможно, факторы роста и цитокины, секретируемые МСК (интерлейкин-10 (IL-10) и фактор некроза опухоли (Tumor Necrosis Factor, TNF-α) (Kiss et al., 2008)) оказали тормозящее влияние на ЗКП, что препятствовало секреции ЗКП факторов роста и дифференцировке МСК в гепатоцитоподобные клетки. В остальном изменения фенотипа МСК были такими же, как при культивировании МСК в питательной среде ЗКП.

В естественных условиях прогениторные клетки находятся под влиянием не только секретируемых факторов роста, но и межклеточных контактов. Для моделирования подобного взаимодействия было проведено совместное культивирование ЗКП и МСК. Предварительное мечение клеток позволило установить, что появление в фенотипе клеток экспрессии эпителиальных маркёров ЦК18, ЦК19 и α-ФП не было вызвано слиянием ЗКП и МСК, а скорее всего, обусловлено дифференцировкой клеток под комплексным влиянием факторов роста и межклеточных контактов. HSA+ клеток в данной модели выявлено не было, что, вероятно, связано с неким тормозящим влиянием со стороны МСК на ЗКП, как и в группе по культивированию ЗКП и МСК в системе внутрилуночных вставок. В отличие от всех предыдущих групп при совместном культивировании ЗКП и МСК количество ЦК19+/ЦК18+/α ФП+ было больше (таблица 1), а экспрессия данных маркёров была более выраженной. Вполне вероятно, что в данном случае в гепатобласты дифференцируются не только МСК, но и сами ЗКП.

Подводя итог, можно сказать, что ЗКП действительно могут создавать микроокружение, благоприятное для роста и дифференцировки внепечёночных стволовых клеток, в частности, МСК костного мозга в клетки с фенотипом гепатобластов и гепатоцитов. Среди компонентов микроокружения важными являются как факторы роста, вырабатываемые ЗКП, так и межклеточные контакты между ЗКП и прогениторными клетками. Наиболее оптимальными вариантами для индуцирования МЭТ и гепатоцитарной дифференцировки МСК являются культивирование МСК в питательной среде ЗКП и совместное культивирование МСК и ЗКП.


Выводы

1. Изолированное культивирование МСК и ЗКП крысы в питательной среде с добавлением рекомбинантных факторов роста FGF4 и HGF приводит к повышению в 4 раза количества культивируемых клеток и их мезенхимно-эпителиальной трансдифференцировке с появлением в фенотипе МСК маркёров гепатобластов ЦК18, ЦК19 и α-ФП на 9-е сутки, а в фенотипе ЗКП – появлению экспрессии ЦК18, ЦК19, α-ФП и HSA на 14-е сутки.

2. Культивирование МСК крысы в среде ЗКП, также как и культивирование МСК и ЗКП крысы, разделённых полупроницаемой мембраной, приводит к повышению количества МСК в 3 раза и появлению экспрессии цитокератинов 18 и 19 и α-ФП на 2 недели позже (на 21-й и 28-й день соответственно), чем при культивировании МСК с рекомбинантными факторами роста. Единичные клетки, экспрессирующие HSA, были выявлены только при культивировании МСК в среде ЗКП.

3. Совместное культивирование МСК и ЗКП приводит к выраженной экспрессии маркёров гепатобластов ЦК18, ЦК19 и α-ФП. Сроки появления экспрессии данных антигенов совпадают с таковыми при культивировании МСК в среде ЗКП.

4. При совместном культивировании МСК и ЗКП слияния клеток не выявлено, изменения фенотипа клеток с мезенхимного на эпителиальный осуществлялись путём дифференцировки под действием растворимых факторов, секретируемых ЗКП, и непосредственных межклеточных контактов.

5. Оптимальным режимом для мезенхимно-эпителиальной трансдифференцировки МСК с появлением в фенотипе культивируемых клеток маркёров гепатобластов ЦК18, ЦК19 и α-ФП является культивирование МСК в среде ЗКП и совместное культивирование МСК с ЗКП.



ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ

Рекомендовать внедрение в лабораторную практику метод коллагеназно-проназной перфузии печени с последующим разделением в градиенте плотности гистоденза для выделения чистой популяции ЗКП, а также метод витального мечения клеток мембранными флуоресцентными метками РКН26 и РКН67 (Sigma) для визуализации клеток разных популяций при совместном культивировании.


СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ

По материалам диссертации опубликовано 30 работ (1 монография, 4 статьи и 25 тезисов).

1. Шафигуллина А.К. Паракринные и контактные влияния перисинусоидальных клеток печени на кроветворные и мезенхимальные стволовые клетки in vitro / А.К. Шафигуллина, А.А. Трондин, А.Р. Шайхутдинова [и др.] // IV Всероссийская научно-практическая конференция «Молодые учёные в медицине». – Казань, 2010. – С. 299-300.

2. Трондин А.А. Сравнительный анализ методов выделения перисинусоидальных клеток Ито из печени крыс / А.А. Трондин, А.Р. Шайхутдинова, А.К. Шафигуллина [и др.] // 84-ая Всероссийская студенческая научная конференция. – Казань, 2010. – С. 259.

3. Трондин А.А. Паракринные и контактные взаимодействия мезенхимальных стволовых клеток и перисинусоидальных клеток печени in vitro / А.А. Трондин, А.Р. Шайхутдинова, А.К. Шафигуллина [и др.] // 84-ая Всероссийская студенческая научная конференция. – Казань, 2010. – С. 258-259.

4. Шайхутдинова А.Р. Влияние перисинусоидальных клеток печени крысы на выживаемость и морфологию кроветворных и мезенхимальных стволовых клеток при различных методах культивирования / А.Р. Шайхутдинова, А.А. Трондин, А.К. Шафигуллина [и др.] // 84 ая Всероссийская студенческая научная конференция. – Казань, 2010. – С. 257-258.

5. Шафигуллина А.К. Изучение влияния клеток Ито на стволовые клетки / А.К. Шафигуллина, А.А. Трондин, А.Р. Шайхутдинова [и др.] // IV Всероссийский симпозиум с международным участием «Актуальные вопросы тканевой и клеточной трансплантологии». – Санкт-Петербург, 2010. – С. 200-201.

6. Гумерова А.А. Гепатоциты и перисинусоидальные клетки печени обладают свойствами стволовых прогениторных клеток в ходе пренатального развития и репаративной регенерации печени / А.А. Гумерова, А.П. Киясов, М.С. Калигин [и др.] // IV Всероссийская научно-практическая конференция «Молодые учёные в медицине». – Казань, 2010. – С. 59-60.

7. Shafigullina A.K. Intercellular and paracrine interactions between hepatic perisinusoidal cells and various adult stem cells / A.K. Shafigullina, A.A. Trondin, A.R. Shaihutdinova [et al.] // 2nd International Student Medical Congress. – Kosice, 2010. – P. 39.

8. Trondin A.A. Comparative analysis of Ito cells deriving methods / A.A. Trondin, A.K. Shafigullina, A.R. Shaihutdinova [et al.] // 2nd International Student Medical Congress. – Kosice, 2010. – P. 109-110.

9. Gumerova A. Perspectives of different populations of stem/progenitor cells in treatment of alcoholic hepatitis / A. Gumerova, S. Abdulkhakov, A. Shafigullina [et al.] // Abstracts of IV Falk Gastro Conference. – Freiburg, 2010. – P. 66.

10. Шафигуллина А.К. Влияние растворимых факторов, вырабатываемых перисинусоидальными клетками печени, на мультипотентные мезенхимальные стромальные клетки костного мозга крысы / А.К. Шафигуллина, А.А. Трондин, А.Р. Шайхутдинова [и др.] // Материлы III Международного Симпозиума «Актуальные вопросы клеточных технологий». – Москва, 2010. – С. 53.

11. Гумерова А.А. Перспективы использования различных популяций стволовых/прогениторных клеток в клеточной терапии заболеваний печени / А.А. Гумерова, А.К. Шафигуллина, С.Р. Абдулхаков [и др.] // Материалы III Международного симпозиума «Актуальные вопросы клеточных технологий». – Москва, 2010. – Клеточная трансплантология и тканевая инженерия. – Т. 5, № 3. – С. 25.

12. Rizvanov A.A. Interaction and self-organization of human mesenchymal stem cells and neuro-blastoma SH-SY5Y cells under co-culture conditions: a novel system for modeling cancer cell micro-environment / A.A. Rizvanov, M.E. Yalvaç, A.K. Shafigullina [et al.] // European Journal of Pharmaceutics and Biopharmaceutics. – 2010. – V. 76, № 2. – Р. 253-259.

13. Шафигуллина А.К. Растворимые факторы, вырабатываемые перисинусоидальными клетками печени, способствуют дифференцировке мезенхимных стволовых клеток костного мозга крысы в гепатоциты in vitro / А.К. Шафигуллина, А.А. Трондин, М.С. Калигин [и др.] // Материалы VI Международной (XV Всероссийской) Пироговской научной медицинской конференции студентов и молодых учёных. – Москва, 2011. – С. 14.

14. Шафигуллина А.К. Взаимовлияния перисинусоидальных клеток печени и мезенхимальных стволовых клеток крысы при совместном культивировании на boyden chambers/ А.К. Шафигуллина, А.А. Трондин, И.М. Газизов [и др.] // XVI Всероссийская научно-практическая конференция «Молодые учёные в медицине». – Казань, 2011. – С. 136.

15. Трондин А.А. Влияние FGF4 и HGF на гепатоцитарную трансдифференцировку клеток Ито in vitro / А.А. Трондин, А.К. Шафигуллина, М.С. Калигин [и др.] // Международная научная конференция студентов и молодых учёных, посвящённая 135-летию М.Д. Стражеска. – Одесса, 2011. – С. 30.

16. Шафигуллина А.К. Сравнительный анализ возможностей дифференцировки в гепатоциты перисинусоидальных клеток печени и мезенхимных стволовых клеток костного мозга крысы под влиянием FGF4 и HGF in vitro / А.К. Шафигуллина, А.А. Трондин, М.С. Калигин [и др.] // Международная научная конференция студентов и молодых учёных, посвящённая 135-летию М.Д. Стражеска. – Одесса, 2011. – С. 31.

17. Shafigullina A. Transplanted hepatic stellate cells do not liver fibrosis in intact rodent liver / A. Shafigullina, A. Trondin, I. Gazizov [et al.] // The 4th International IMBG conference for young scientists “Molecular Biology: Advances and Perspectives”. – Kyiv, 2011. – P. 178.

18. Shafigullina A. Hepatic stellate cells transplantation – cause liver fibrosis or liver regeneration? / A. Shafigullina, A. Trondin, I. Gazizov [et al.] // 22nd European Student`s Conference “Promising medical Scientists willing to look beyond”. – Berlin, 2011. – P. 29-30.

19. Шафигуллина А.К. Трансплантированные звёздчатые клетки печени восстанавливают популяцию гепатоцитов без риска развития фиброза печени / А.К. Шафигуллина, А.А. Гумерова, А.А. Трондин [и др.] // II Международная научно-практическая конференция «Достижения, инновационные направления, перспективы развития и проблемы современной медицинской науки, генетики и биотехнологий». – Екатеринбург, 2011. – С. 241.

20. Гумерова А.А. Звёздчатые клетки печени стимулируют дифференцировку мезенхимальных стволовых клеток костного мозга крысы в гепатоциты in vitro / А.А. Гумерова, А.К. Шафигуллина, А.А. Трондин [и др.] // Клеточная трансплантология и тканевая инженерия. – 2011. – Т. 6, № 4. – С. 72-81.

21. Шафигуллина А.К. Пути дифференцировки свежевыделенных и культивированных in vitro звёздчатых клеток печени после трансплантации интактным крысам и крысам после частичной гепатэктомии / А.К. Шафигуллина, А.А. Трондин, И.М. Газизов [и др.] // XVII Всероссийская научно-практическая конференция «Молодые учёные в медицине». – Казань, 2012. – С. 115.

22. Шафигуллина А.К. Звёздчатые клетки печени дифференцируются в гепатоциты in vitro и in vivo / А.К. Шафигуллина, А.А. Трондин, И.М. Газизов [и др.] // Научно-практическая конференция с международным участием, посвящённая 155-летию со дня рождения В.В. Подвысоцкого. – Одесса, 2012. – С. 42.

23. Шафигуллина А.К. Трансплантация перисинусоидальных клеток печени – фиброз или регенерация? / А.К. Шафигуллина, А.А. Гумерова, А.А. Трондин [и др.] // XI Конгресс Международной Ассоциации морфологов. – Самара, 2012. – С. 176.

24. Shafigullina A. Hepatic stellate cells differentiate into hepatocyte-like cells in vitro and in vivo / A. Shafigullina, A. Gumerova, A. Trondin [et al.] // 47th Annual meeting of the European Association for the Study of the Liver. – Barcelona, 2012. – V. 56. – P. S172.

25. Gumerova A. Hepatic stellate cells as a source for hepatocyte differentiation but no hepatic fibrosis development / A. Gumerova, A. Shafigullina, A. Trondin [et al.] // 47th Annual meeting of the European Association for the Study of the Liver. – Barcelona, 2012. – V. 56. – P. S166.

26. Shafigullina A. Dual nature of hepatic stellate cells in the liver: stem cells/progenitor cells microenvironment component / A.Shafigullina, A.Gumerova, A.Trondin [et al.] // 20th United European Gastroenterology Week. – Amsterdam, 2012. – P. A106.

27. Gumerova A. Cell sources of liver development and regeneration. In search of hepatic stem cells / А. Gumerova, А. Kiassov, S. Abdulkhakov, I. Gazizov, A. Shafigullina, D. Andreeva, A. Trondin, M. Kaligin, M. Titova, T. Yilmaz. – LAP Lambert Academic Publishing. – 2012. – 128.

28. Шафигуллина А.К. Трансплантированные звёздчатые клетки печени участвуют в регенерации органа после частичной гепатэктомии без риска развития фиброза печени / А.К. Шафигуллина, А.А. Гумерова, А.А. Трондин [и др.] // Клеточная Трансплантология и Тканевая Инженерия. – 2012. – Т.7, №3. – C. 169-172.

29. Шафигуллина А.К. Участие свежевыделенных и активированных in vivo звёздчатых клеток печени в регенерации печени крыс после частичной гепатэктомии и повреждения четырёххлористым углеродом / А.К. Шафигуллина, Г.Р. Бурганова, А.А. Трондин // 87-я Всероссийская научно-практическая конференция студентов и молодых учёных, посвящённая 155-летию со дня рождения Л.О. Даркшевича. – Казань, 2013. – С. 211.

30. Шафигуллина А.К. Сравнение различных методов выделения, мечения и трансплантации звёздчатых клеток печени крысы / А.К. Шафигуллина, А.А. Трондин, Г.Р. Бурганова [и др.] // Клеточная Трансплантология и Тканевая Инженерия. Сборник трудов Института Фундаментальной медицины и биологии Казанского (Приволжского) федерального университета. – 2013. – Т.8, №3. – C. 147-151.



СПИСОК СОКРАЩЕНИЙ

α-ГМА – альфа-гладкомышечный актин

α-ФП – альфа-фетопротеин

ЦK – цитокератин

ПЦР – полимеразная цепная реакция

EGF – Epidermal Growth Factor, эпидермальный фактор роста

ESA – Epithelial Specific Antigen, эпителиальный специфичный антиген

FGF4 – Fibroblast Growth Factor 4, фактор роста фибробластов 4

HGF – Hepatocyte Growth Factor, фактор роста гепатоцитов

HSA – Hepatocyte Specific Antigen, специфический антиген гепатоцитов

IL-10 – Interleukin-10, интерлейкин -10

PCNA – Proliferating Cell Nuclear Antigen, ядерный антиген пролиферирующих клеток

SCF – Stem Cell Factor, фактор стволовых клеток

TNF – Tumor Necrosis Factor, фактор некроза опухоли

VCAM – Vascular Cell Adhesion Molecule, сосудистая молекула клеточной адгезии

Формат 60х84 1/16. Бумага офсетная. Печать офсетная.

Усл. печ. л. 2,5.

Гарнитура Times New Roman. Тираж 110 экз. Заказ № 67.

Подписано в печать 10.02.2012 г.

Отпечатано с готового оригинал-макета

в типографии «АртПечатьСервис» ИП Мартынов

420061, г. Казань, ул. Космонавтов, 41.



Тел. 295-10-19

1 Выделение ЗКП из печени крыс выполнено совместно с врачом-ординатором кафедры неврологии и нейрохирургии ФПК и ППС Трондиным А.А.

2 Молекулярно-биологическая часть диссертации была выполнена при консультации зав. кафедрой генетики КФУ, доцента, д.б.н. Ризванова А.А.

3 Постановка ПЦР с обратной транскрипцией и электрофорез ДНК в 1,5% агарозном геле были выполнены совместно с научным сотрудником Отдела генных и клеточных технологий НОЦ «Фармацевтики» К(П)ФУ Соловьёвой В.В.