И. Г. Асылбаев Редакционная коллегия - shikardos.ru o_O
Главная
Поиск по ключевым словам:
Похожие работы
И. Г. Асылбаев Редакционная коллегия - страница №1/11



МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ

ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ ОБРАЗОВАТЕЛЬНОЕ

УЧРЕЖДЕНИЕ ВЫСШЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ

«БАШКИРСКИЙ ГОСУДАРСТВЕННЫЙ АГРАРНЫЙ УНИВЕРСИТЕТ»


СОВРЕМЕННЫЕ ОСНОВЫ

РАЦИОНАЛИЗАЦИИ
ТЕХНОЛОГИИ ВОСПРОИЗВОДСТВА СЕЛЬСКОХОЗЯЙСТВЕННЫХ ЖИВОТНЫХ В УСЛОВИЯХ ИНДУСТРИАЛЬНОЙ СИСТЕМЫ ПРОИЗВОДСТВА В АПК


Материалы

всероссийской молодежной научной школы


в рамках Федеральной целевой программы
«Научные и научно-педагогические кадры
инновационной России» на 2009-2013 годы

(Уфа, Россия, 11-14 сентября 2012 г.)

Уфа

Башкирский ГАУ



2012

УДК 636


ББК 45/46

С 56


Ответственный за выпуск:

канд. с.-х. наук, доцент,

проректор по научной и инновационной деятельности

ФГБОУ ВПО Башкирский ГАУ И.Г. Асылбаев

Редакционная коллегия:

канд.с.-х.н., доцент Ф.Р. Валитов

д-р с.-х.н., профессор Р.Р. Султанова

канд.с.-х.н., доцент Л.В.Герасимова

канд.с.-х.н., ассистент А.Г. Ильясов

С 56 Современные основы рационализации технологии воспроизводства сельскохозяйственных животных в условиях индустриальной системы производства в АПК. Материалы всероссийской молодежной научной школы в рамках Федеральной целевой программы «Научные и научно-педагогические кадры инновационной России» на 2009-2013 годы (Уфа, Россия, 11-14 сентября 2012 г.). – Уфа: Башкирский ГАУ, 2012. – 216 с.

ISBN 978-5-7456-0314-3

В сборнике опубликованы доклады выступлений участников всероссийской молодежной научной школы «Современные основы рационализации технологии воспроизводства сельскохозяйственных животных в условиях индустриальной системы производства в АПК» в рамках Федеральной целевой программы «Научные и научно-педагогические кадры инновационной России» на 2009-2013 годы.

Материалы сборника посвящены актуальным проблемам научных исследований в области биотехнологии, современных проблем ветеринарного акушерства и биотехники репродукции животных, совершенствованию воспроизводства и селекции сельскохозяйственных животных.

Статьи приводятся в авторской редакции. Авторы опубликованных статей несут ответственность за патентную чистоту, достоверность и точность приведенных фактов, цитат, экономико-статистических данных, собственных имен, географических названий и прочих сведений, а также за разглашение данных, не подлежащих открытой публикации.


УДК 636

ББК 45/46


ISBN 978-5-7456-0314-3 © Башкирский ГАУ, 2012
УДК 619:636.1

СОСТОЯНИЕ И ПЕРСПЕКТИВЫ ТЕХНОЛОГИИ ТРАНСПЛАНТАЦИИ ЭМБРИОНОВ В КОНЕВОДСТВЕ

Л.Ф.Лебедева

ГНУ Всероссийский научно-исследовательский


институт коневодства, г. Рязань
Технология трансплантации эмбрионов лошадей начала развиваться в начале 70-х годов прошлого столетия. Метод трансплантации эмбрионов позволяет получать по 10 и более жеребят в год от одной ценной племенной кобылы; а также от выдающихся спортивных кобыл без выключения их из режима соревнований, либо от ценных кобыл, способных к зачатию, но по разным причинам не способных выносить плод. Эмбрионы можно перевозить в течение 1-2-х суток в специальных средах при температуре (+37)ºС или (+ 5)ºС с целью последующей пересадки, а также неопределенно долго хранить и транспортировать их в замороженном виде в жидком азоте (-196ºС). Жеребят-трансплантатов, родившихся от одной кобылы и разных жеребцов-производителей в ставке года можно испытывать в одной возрастной группе (экспресс-оценка жеребцов по качеству потомства).

Сущность метода сводится к тому, чтобы избавить ценную кобылу от 11-месячного процесса вынашивания плода и передать эту миссию суррогатной матери. Для этого из матки кобылы-донора нехирургическим методом извлекают 7-8-суточный эмбрион и пересаживают его в матку синхронизированной по фазе полового цикла кобыле-реципиенту. В следующем половом цикле кобыла-донор снова будет готова к зачатию и очередной процедуре трансплантации эмбриона.

Таким образом, удается более эффективно работать с маточными семействами и тиражировать удачные сочетания подобранных пар, способствуя селекционному прогрессу. Современные технологии предусматривают работу со свежими, охлажденными и замороженными эмбрионами. Процент приживляемости свежих и охлажденных эмбрионов несколько выше, чем замороженных (70-85% против 55-60% [1].

В настоящее время ведущее положение в области трансплантации эмбрионов занимают США, Аргентина и Бразилия. К странам, использующим эмбриопересадки в коневодстве в меньших масштабах, относятся Австралия, Канада и большинство европейских государств, в частности Австрия, Франция, Италия, Греция, Финляндия, Швеция, Дания, Германия, Венгрия.



В сравнении с другими отраслями животноводства, особенно со скотоводством, где индустрия трансплантации эмбрионов располагает сетью криобанков, в которых хранятся зародыши с определенным происхождением и полом, наша отрасль сильно отстает и сопоставима с козоводством (Таблица 1).
Таблица 1 Статистика пересадок эмбрионов сельскохозяйственных животных в странах Европы по годам [2]


Год

Количество эмбрионов (получено/пересажено)

Лошади

КРС

овцы

свиньи

козы

1999

222/194

170451/143168

6744/6330

3995/534

303/176

2000

563/226

151525/119769

847/440

816/619

243/145

2001

309/260

122725/107342/

613/441

302/184

198/103

2002

115/74

114080/102176

501/398

1338/995

76/53

2003

413/344

116907/98918

326/167

1221/816

61/52

2004

446*/387

110148/98130

99/70

389/387

41/41

2005

509*/711

115178/93034

83/61

271/192

160/76

2006

428*/884 (IVP**- 12)

106857/95030

161/196

292

110/105

2007

764/622 (IVP-32)

123739/108841

138/212

621/32

134/128

2008

1043/1014 (IVP-48)

123176/101149

419/375

736/28

83/75

2009

1024*/1037 (IVP-69)

114148/100678

197/143

716/20

-

2010

289/123

109646/114976

273/476

-

-

*некоторые страны не представили данные

** эмбрионы получены методом искусственного оплодотворения (IVP- In Vitro Production)

- нет данных
Данные таблицы 1 наглядно демонстрируют наращивание темпов использования технологии эмбриотрансплантации в европейском коневодстве, за исключением 2010 года, очевидно отражающего последствия мирового экономического кризиса. В скотоводстве, напротив, бурный всплеск интереса к новым репродуктивным технологиям на рубеже ХХ-ХХI веков постепенно сменяется стабильным уровнем использования метода эмбриопересадок в рутинной практике воспроизводства. Следует уточнить, что в массе ежегодно трансплантируемых в Европе эмбрионов КРС, примерно, 50-60% составляют замороженные эмбрионы и 5-10% - эмбрионы, полученные методом искусственного оплодотворения (IVP- In Vitro Production). В европейском коневодстве сообщения о пересадках эмбрионов «из пробирки» появляются лишь с 2006 года.

Причин такого положения дел в коневодстве несколько. Проблема вызова суперовуляции у кобыл выражается в дефиците эмбрионов для работы (например, у коров после гормональной обработки можно в одном половом цикле извлечь до 30 эмбрионов, а у кобыл, в силу физиологических особенностей, лишь 1-2 эмбриона [3]. Продолжительная охота и непредсказуемость сроков овуляции создают проблемы синхронизации половых циклов донора и реципиента. Процедура извлечения и пересадки эмбрионов требует высокой квалификации исполнителей и существенных материальных затрат (средняя стоимость эмбриопересадки в Америке сегодня составляет от 2000$ до 5000 $). Но главная причина состоит в системе ограничений (арабская, американская стандартбредная порода и др.) и запретов (английская чистокровная верховая порода, Palomino Ponies, American Suffolk Horse и др.) некоторых породных регистров/ассоциаций на выдачу племенных документов для жеребят-трансплантатов. Тем не менее, большинство Советов ведущих спортивных, рысистых и выставочных пород мира допускают жеребят-трансплантатов к записи в племенные книги. В их числе тракененские, голштинские, ахалтекинские, практически все «теплокровные» западноевропейские лошади. Под натиском научно-технического прогресса, передовых технологий и здравого смысла консерваторы постепенно сдают свои позиции и включают эмбриопересадки в селекционные программы разведения лошадей. В России первый жеребенок-трансплантат родился в феврале 1982 года в лаборатории физиологии размножения лошадей ВНИИ коневодства [4]. Автором отечественной технологии эмбриопересадки С.Г.Лебедевым было получено около 40 жеребят-трансплантатов. После научно-исследовательского «застоя» и экономического кризиса времен перестройки сотрудники лаборатории продолжили изыскания в области трансплантации эмбрионов лошадей. В числе последних разработок: методы культивирования in vitro и криоконсервации ранних (6-8 суток) эмбрионов, нехирургического извлечения эмбрионов предимплантационных стадий (вплоть до 40-х суток развития). Проведены фундаментальные исследования в области раннего эмбриогенеза лошадей на основе гистологии и электронной микроскопии. Начата работа по выделению и исследованию регенерационных возможностей эмбриональных стволовых клеток лошадей. В последнее время оживляется интерес коневладельцев к эмбриотрансплантации, растет квалификация российских специалистов. Эта тенденция обнадеживает и внушает надежду на дальнейшее развитие отечественной коневодческой науки и практики.


Литература:

1.Squires, EL, McCue, PM and Vanderwall, D (1999) The current status of equine embryo transfer. Theriogenology 51 91-110

2. www.aete.eu/publications

3. Niswender, KD, Alvarenga, MA, McCue, PM, Hardy, QP and Squires EL (2003) Superovulation in cycling mares using equine follicle stimulating hormone (eFSH). J Equine Vet Sci 23 487-500

4.Лебедев, С.Г. Трансплантация эмбрионов лошадей [Текст] //Дисс. на соиск. уч. ст. д.б.н. ВНИИК. Дивово,1994.

УДК 636.52/58.082.2



АЛЛЕЛЬНЫЕ ВАРИАНТЫ ГЕНОВ, КОНТРОЛИРУЮЩИХ ХОЗЯЙСТВЕННО-ПОЛЕЗНЫЕ ПРИЗНАКИ
У КУР ГЕНОФОНДНЫХ ПОРОД


В.П. Терлецкий, Д.О. Доронин, В.И. Тыщенко, А.Б. Вахрамеев

ГНУ Всероссийский научно-исследовательский институт


генетики и разведения сельскохозяйственных животных,
г. Санкт-Петербург-Пушкин
Хозяйственно-полезные признаки контролируются многими генами, полиморфизм которых можно изучить, используя метод полимеразной цепной реакции (ПЦР). Цель наших исследований заключалась в выявлении генетической изменчивости по аллельным вариантам кур 10-ти генофондных пород с использованием двух генов – интрона 2 гена гормона роста (GHR) и гена инсулиноподобного фактора роста (IGF-1).

Известно, что эти гены связаны со скоростью роста у птиц и млекопитающих [1,2]. Кроме того, есть данные, что продукт гена инсулиноподобного фактора роста связан с воспроизводительными качествами кур [3]. Материалом исследования служили образцы крови, взятой из подкрыльцовой вены кур 10-ти пород и экспериментальных популяций (по 12 образцов в каждой группе). ДНК из крови выделяли по общепринятым методикам.

Следующим этапом работы была амплификация последовательностей ДНК в интроне 2 гена гормона роста (GHR) и гена инсулиноподобного фактора роста (IGF-1). Последовательность нуклеотидов праймеров и некоторая другая информация представлена в таблице 1. Праймеры подбирались с таким расчетом, чтобы продукт амплификации имел сайт рестрикции для ферментов HindIII и PstI для генов GHR и IGF-1, соответственно [4].
Таблица 1 Последовательности праймеров для амплификации интрона 2 гена гормона роста (праймеры 1 и 2) и гена инсулиноподобного фактора роста (праймеры 3 и 4)


Праймер

5'-3'

ПЦР-продукт

рестриктаза

  1. прямой




  1. обратный




  1. прямой




  1. обратный

GGCTCTCCATGGGTATTAGGA
GCTGGTGAACCAATCTCGGTT
GACTATACAGAAAGAACCCAC
TATCACTCAAGTGGCTCAAGT

718 п.н.

621 п.н.

HindIII

PstI

После синтеза отобранных праймеров нами были подобраны оптимальные условия проведения полимеразной цепной реакции (ПЦР) с этими праймерами. Реакцию проводили в 25 мкл реакционной смеси, содержащей 67 мМ трис -HCl pH 8,6 - 2,5 мM MgCl2 - 16,6 мM NH4OH - 0,125 мМ каждого из дезоксирибонуклеотидтрифосфатов (dATP, dGTP, dCTP, dTTP) -0,5 мкМ праймера - 50-100 нг геномной ДНК и 2,5 ед Taq-полимеразы ("Силекс М", Москва или ООО "Биолаб", Санкт-Петербург). Реакцию проводили на амплификаторе "Терцик". Использовали режим, состоящий из 35 циклов: 30 сек - 94˚С, 1 мин 37˚С, 1 мин - 72˚С.

В качестве способа выявления аллельных вариантов был использован метод ПЦР-ПДРФ, когда продукт специфической амплификации подвергался расщеплению ферментом рестрикции. Наличие или отсутствие сайта расщепления определяет размер фрагмента ДНК. В пробирку помещали 25 мкл амплификата непосредственно в ПЦР-буфере, добавляли 0,5 мкл рестриктазы HindIII/PstI, перемешивали и ставили инкубировать на 3 часа при 37оC.

После завершения расщепления ДНК ферментами рестрикции проводили электрофорез. Для электрофореза использовали 0,8% агарозные гели, содержащие флуоресцентный краситель бромистый этидий. Электрофорез проводили в течение 1 часа при рабочем напряжении 150 В. В качестве маркера, позволяющего оценить длину фрагментов ДНК на геле использовали фрагменты ДНК FastRuler Middle Range (размер фрагментов 100 п.н - 5000 п.н.). После расщепления продуктов амплификации ферментом HindIII/PstI и разделения полученных фрагментов ДНК в агарозном геле, флуоресцентный сигнал фотографировали в системе гель-документации фирмы Bio-Rad. Амплификация гена и расщепление фрагмента ДНК приводит к выявлению аллельных вариантов генов, как в гомозиготном, так и в гетерозиготном состоянии (рисунок 1).


М 1 2 3 4 5 6 7 8 9 10 11 12


Рисунок 1 Результаты рестрикции (фермент PstI) ДНК Царскосельской породы кур по гену IGF-1. (М-маркер, № 2 и 8 – гомозиготный генотип С1С1, № 3 и 11 – гетерозиготный генотип С1С2,
№ 1,4,5,6,7,9,10,12 – гомозиготный генотип С2С2).
Метод ПЦР-ПДРФ, использованный на 10 породах и популяциях кур (Голошейная, Пушкинская, Фавероль, Аврора, Род-Айланд, Орловская, Царскосельская, Кохинхин, Узбекская бойцовая, Брама) по интрону гена GHR не выявил достоверных различий по частотам встречаемости аллельных вариантов. В то же время, анализ образцов ДНК по аллелям гена IGF-1, проведенный на 7 генофондных породах кур показал наличие достоверных различий между породами (таб. 2).
Таблица 2 Генотипы 7 пород и популяций кур, выявляемые методом ПЦР-ПДРФ по гену IGF-1 (12 голов в каждой группе).


Название породы/популяции

Количество генотипов

С1С1



Количество генотипов

С2С2



Количество генотипов

С1С2



Голошейная

3

6

3

Пушкинская

0

8

4

Фавероль

2

5

5

Аврора

3

8

1

Род-Айланд

0

12

0

Орловская

0

11

1

Царскосельская

2

8

2

Были обнаружены гомозиготные варианты организации этого гена С1С1 (621 п.н., отсутствие рестрикции) и С2С2 (257 и 364 п.н.), а также гетерозиготный вариант С1С2 с длинами фрагментов ( 257, 364 и 621 п.н. )

Таким образом, метод ПЦР-ПДРФ можно использовать для выявления аллельных вариантов гена инсулиноподобного фактора роста в генофондных породах и популяциях кур с целью их генетической характеристики
Литература:


  1. C. Beccavin, B. Chevalier, L.A. Cogburn, J. Simon, M.J. Duelos. Insulin-like growth factors and body growth in chickens divergently selected for high or low growth rates. J. Endocrinol., 2001, v. 168, p. 297-306.

  2. Feng, X.P, Kuhnlein, U., Aggrey, S.E., Gavora, J.S., Zadworny, D. Trait association of genetic markers in the growth hormone and the growth hormone receptor gene in a White Leghorn strain. Poult. Sci., 1997, v76, p.1770-1775.

  3. E. Decuypere, L.M. Huybrechts, E. Kuhn, M. Tixier-Boichard, P. Merat. Physiological alterations with the chicken sex-linked dwarfing gene. Crit.Rev.Poult.Biol., 1991, v.3, p.191-221.

  4. H.F.Li, W.Zhu, K.W.Chen, X. Wu, Q.P. Tang, Y. Gao. Associations between GHR and IGF-1 Gene Polymorphisms, and Reproductive Traits in Wenchang Chickens. Turk.J.Vet.Anim.Sci., 2008, v. 32, p.281-285.

УДК 619:616.5:636.1

ВЫЯВЛЕНИЕ МИКОПЛАЗМЕННОЙ ИНФЕКЦИИ
У ЛОШАДЕЙ МЕТОДОМ ПОЛИМЕРАЗНОЙ
ЦЕПНОЙ РЕАКЦИИ


В.П. Терлецкий, А.А. Крутикова, Е.В. Никиткина,

Д.О. Доронин, В.И. Тыщенко

ГНУ Всероссийский научно-исследовательский институт


генетики и разведения сельскохозяйственных животных,
г. Санкт-Петербург-Пушкин
Снижение репродуктивных качеств у животных, в том числе лошадей, сейчас становится все более актуальной проблемой. Связано это с тем, что у племенных животных значительные ресурсы организма отвлекаются на формирование селектируемых признаков, в то время как защитные свойства иммунной системы ослабляются. Условно-патогенные микроорганизмы получают шанс не просто на выживание, но и на активный рост, который сопровождается накоплением продуктов их жизнедеятельности.

Эти продукты вместе с бактериальными токсинами изменяют свойства слизистых оболочек половых путей, что сказывается на репродуктивных качествах животных.

Вступая в синергические отношения с вирусной, бактериальной и условно-патогенной микрофлорой, микоплазмы создают условия для ее активного роста и развития, что усиливает тяжесть течения данного заболевания [1,2,3]. Особенностью организма микоплазм является чрезвычайно малый физический размер (до 1 микрометра) и малый размер генома [4].

Биологические свойства микроорганизмов, обитающих в половых путях таковы, что инфекцию трудно выявить на ранних стадиях заболевания, в связи с тем, что она протекает бессимптомно. Даже в случае появления симптомов, доказать природу вызывающих их патогенов классическими методами крайне затруднительно, так как многие инфекции протекают со сходными симптомами.

Ранние сроки выявления возбудителя означают более высокую эффективность лечения. Молекулярно-генетический метод полимеразной цепной реакции (ПЦР), в отличие от многих других методов, способен выявлять ничтожно малое число бактериальных клеток (несколько десятков микробных клеток в 1 мл биологического материала) на ранних сроках развития инфекции. Своевременное выявление животных-носителей инфекции позволяет более эффективно проводить лечебные и профилактические мероприятия, направленные на повышении репродуктивной функции у животных и лечения бесплодия. Данный метод хорошо зарекомендовал себя в медицине. В последние годы метод ПЦР, включая ПЦР в реальном времени (real-time PCR) активно начинает использоваться и в ветеринарной практике [5]. За рубежом метод ПЦР давно уже стал стандартным в практике животноводства.

Цель исследования состояла в выяснении распространенности микоплазменной инфекции в группе лошадей. Исследуемый материал отбирали у племенных лошадей ФХ Маланичевых и ООО «Ковбой». Слизь из половых путей самок собирали в пробирки и замораживали до использования. ДНК выделяли согласно инструкции к набору «Мик-Ком» ФГУН ЦНИИЭ Роспотребнадзора.

В пробирки с лизирующим раствором вносим 100 мкл пробы. Образец тщательно перемешиваем на вортексе и прогреваем 5 мин при температуре 65˚С. Центрифугируем 5 секунд при 5000 об/мин на микроцентрифуге. В каждую пробирку затем вносим 25 мкл универсального сорбента. Перемешиваем на вортексе, оставляем инкубироваться 2 минуты, затем еще раз перемешиваем на вортексе, инкубируем дополнительно 5 минут. Осаждаем сорбент центрифугированием при 5000 об/мин в течение 30 секунд. Удаляем надосадочную жидкость, затем вносим по 300 мкл раствора для отмывки №1. Перемешиваем на вортексе, осаждаем сорбент центрифугированием, удаляем надосадочную жидкость. Вносим 500 мкл раствора для отмывки №2, перемешиваем на вортексе, центрифугируем, удаляем надосадочную жидкость. Повторяем процедуру отмывки с использованием раствора для отмывки №2. Подсушиваем сорбент универсальный после удаления надосадочной жидкости в термостате при 65˚ градусах по Цельсию в течение 5-10 минут. В пробирки вносим по 50 мкл ТЕ-буфера для элюции ДНК. Перемешиваем на вортексе, инкубируем в термостате при 65˚С в течение 5 минут с периодическим встряхиванием. При этом ДНК отделяется от сорбирующих шариков и переходит в раствор. Центрифугируем пробирки на максимальных оборотах микроцентрифуги в течение 1 минуты. Надосадочная жидкость содержит очищенную ДНК, которая в последующем используется в реакции ПЦР.

1 2 3 4 5 6 7 М 8 9 10 11 12 13 М 14 15 ПК




509 п.о.
микоплазма лошади

Рисунок 1 Электрофореграмма продуктов полимеразной цепной реакции на выявление носительства микоплазменной инфекции у 15 лошадей ФХ «Маланичевых» (1- Бессарабия, 2-Альянс, 3-Баллада,


4-Дельба, 5-Варвара, 6-Румба, 7-Графита, 8-Улыбка) и ООО «Ковбой» (9-Пихта, 10-Дзинтари, 11-Капля, 12-Малахия, 13-Лия, 14-Хибара, 15-Лолита). ПК – положительный контроль. М – маркер. Наличие полосы на уровне полосы у положительного контроля (509 пар оснований ДНК, указано стрелкой) означает присутствие микоплазменной ДНК в образце
ПЦР проводим в объеме 25 мкл. Используя прилагаемые к набору «Мик-Ком» пробирки, вносим на поверхность воска 10 мкл ПЦР-смеси-2 blue. Сверху прибавляем 1 каплю стерильного минерального масла. Затем вносим по 10 мкл выделенной ДНК и ставим пробирки вместе с положительным и отрицательным контролями в термоциклер. Условия проведения ПЦР описаны в инструкции к набору. После окончания ПЦР пробы отбирались из нижней фазы и вносились в лунки 2% агарозного геля, содержащего флуоресцентный краситель бромистый этидий. Выявление продуктов амплификации проводили после 30 минутного электрофореза при напряжении 150 вольт (Рисунок 1).

Ранее нами было проведено тестирование 30 голов коров из племенных хозяйств Ленинградской области, которое показало наличие микоплазм во всех образцах. В отличие от коров, микоплазменная инфекция была выявлена не у всех лошадей. Не обнаружена микоплазма у кобылы, которая ни разу не была в случке и искусственном осеменении, и у трех кобыл, регулярно приносящих жеребят. Почти все кобылы, у которых выявлена микоплазма, имеют проблемы с воспроизводством: низкая зажеребляемость, особенно у кобыл Дзинтари и Бессарабии, у Хибары – аборт на позднем сроке жеребости, у Пихты – эндометрит. Исключение составляет только Румба, которая регулярно приносит жеребят. Скорое всего это связано с хорошим иммунитетом этой кобылы, который подавляет микоплазму. Микоплазмоз может быть одной из причин низкого уровня воспроизводства у лошадей.

Таким образом, молекулярно-генетический метод выявления микоплазменной инфекции позволяет достоверно выявить инфицированных животных. На примере лошадей прослеживается четкая связь между микоплазмозом и репродуктивными качествами кобыл.
Литература:


  1. Прозоровский, С.В.и др. Персистенция микоплазм в инфицированном организме: наблюдения, причины и механизмы, диагностика. [Текст]:// ЖМЭИ.-1997.-№4.-С. 47-51.

  2. Андреев, Е.В. Смешанная вирусомикоплазменная инфекция [Текст] / Е.В.Андреев,П.П/ Фукс //Ветеринария.- 1980.- №8.-C. 30 -32.

  3. Шкиль, Н. Н. Эпизоотологические и иммунологические аспекты микоплазмоза телят во взаимосвязи с бруцеллезом и другими инфекциями [Текст]: Автореф. дис…. канд. ветеринар. Наук. - Новосибирск, 2000.- 23 с.

  4. Маркина, О.С. Сравнительное изучение геномов микоплазм, инфицирующих рогатый скот [Текст]: Автореф. дис…. канд. ветеринар. наук.// Казань, 1995. -22 с.

  5. Bashiruddin, J.B., Frey J., Konigsson M.N. Evaluation of PCR systems for the identification and differentiation of Mycoplasma agalactiae and Mycoplasma bovis: a collaborative trial // Vet. J.- 2005.-v. 169.-P. 268-343.

УДК 636.1.082.2



ИСПОЛЬЗОВАНИЕ ГЕНЕТИЧЕСКИХ МАРКЕРОВ
В СЕЛЕКЦИИ ЛОШАДЕЙ


д.с.-х.н. Л.А. Храброва

ГНУ ВНИИ коневодства Россельхозакадемии, г.Рязань


Современные генетические подходы к совершенствованию пород основаны на более полной оценке генотипа животных и генетического разнообразия популяций с помощью разных маркерных технологий, включая контроль происхождения, маркер-вспомогательную селекцию и интрогрессию (межвидовой перенос генов). Использование маркерных генов для генетической экспертизы происхождения лошадей уже вошло в практику коннозаводства многих стран и стало обязательным элементом племенной работы с заводскими породами лошадей [1]. На сегодня наиболее актуальной задачей является изучение возможностей использования маркер-вспомогательной селекции и внедрения результатов научных исследований в коневодческую практику.

Благодаря успешному завершению международного проекта по изучению генома лошади, уже изучена структура всех хромосом и известна локализация многих сотен генов, участвующих в сложных биохимических реакциях. С помощью ДНК-технологий были выявлены мутантные гены, вызывающие у лошадей серьезные наследственные заболевания, такие как саркомы, комбинированный иммунодефицит (SCID), церебральная атрофия (СА), гиперкалиемический паралич (HYPP) и многие другие. Общее число определяемых у лошадей маркерных генов уже превысило несколько десятков, что позволяет надежно контролировать значительную часть ее генома. Более того, систематическое тестирование всего поголовья лошадей заводских и местных пород создает реальную основу для внедрения генетического мониторинга и других методов маркерной селекции в практику коневодства. Связь между аллельными генами и селекционируемыми признаками животных теоретически возможна через разные генетические механизмы, включая детерминацию структурных генов и их плейотропное действие на формирование хозяйственно-полезных признаков. Данные модельного анализа свидетельствуют, что отбор животных по генетическим маркерам эффективен даже при отсутствии плейотропии и сцепления. Такие корреляции могут быть постоянными в ряде поколений, если они поддерживаются отбором, подбором и закрепляются инбридингом. В любом случае даже временные связи маркерных генов с хозяйственно-полезными признаками могут быть использованы в племенной работе с конкретными популяциями животных. Важным следствием открытия полиморфизма структурных генов и ДНК у сельскохозяйственных животных, в том числе лошадей, явилась возможность оценки степени гетерозиготности как конкретной особи, так и родственной группы животных и каждой популяции. Это очень важно для практической селекции, так как, при интенсивной селекции такие признаки, как работоспособность, крепость конституции, приспособленность, выраженность типа и экстерьера фенотипически проявляются при достаточно высоком уровне гетерозиготности. Сохранение большого количества аллелей даже у малочисленных пород указывает на существование механизмов, препятствующих сужению генетической изменчивости [3,4].

Обобщение литературных данных и результатов собственных исследований по изучению и использованию полиморфизма систем крови и ДНК лошадей, проведенных у нас в стране и за рубежом, показывает, что основными направления использования маркерной селекции в коневодстве являются следующие:


  • Изучение генетической структуры пород и популяций лошадей, включая оценку степени биоразнообразия и других популяционных характеристик;

  • Оценка степени генетических различий, изучение происхождения и микроэволюции пород;

  • Проведение генетического мониторинга в породах лошадей, сохранение оригинальности и гетерогенности аллелофонда малочисленных пород;

  • Совершенствование метода линейного разведения. Генетическая оценка степени дифференциации генеалогической структуры породы, определение генетического сходства с родоначальником линии;

  • Контроль использования родственного разведения, включая мониторинг за нарастанием гомозиготности и оценку результатов инбридинга;

  • Селекция лошадей по маркерам, определяющими хозяйственно-полезные признаки;

  • Диагностика наследственных дефектов и заболеваний, в том числе SCID, СА, LES, HYPP и др.

Систематическое тестирование лошадей в РФ позволяет не только проводить генетическую экспертизу происхождения, но и дает возможность селекционерам использовать имеющуюся информацию о типах полиморфных систем крови и микросателлитах ДНК в качестве маркеров генотипа животных при решении всех задач теоретической и практической селекции.

В настоящее время Государственный реестр селекционных достижений включает 44 породы и 5 типов лошадей, и практически все из них прошли генетическую паспортизацию во ВНИИ коневодства. Оказалось, что практически все изученные породы имеют своеобразный аллелофонд, отражающий происхождение, направление их хозяйственного использования и степень генетического родства. Общепризнанно, что степень разнообразия полиморфных генов в настоящее время является объективным и информативным критерием оценки генетической изменчивости и самобытности популяций и пород.

При изучении молекулярно-генетических характеристик разных пород лошадей было установлено, что каждая из них имеет особую генетическую структуру. Кластерный анализ выявил, что изученные породы четко подразделяются на два субкластера, в один из которых входят только заводские, а во второй – преимущественно местные породы лошадей.

Генетический мониторинг в коневодстве особенно актуален в связи с небольшой численностью племенного поголовья многих отечественных пород, включая буденовскую, владимирскую, донскую, терскую и др. Он дает возможность дополнить традиционную селекцию новыми технологиями и позволяет вести отбор и подбор не только на фенотипическом, но и на генотипическом уровне. Одна из основных задач генетического мониторинга - это поддержание в породах генетического разнообразия, что является необходимым условием для творческой селекционной работы [2].

Мониторинг аллелофонда 6 заводских пород показал, что динамика генетических процессов в группах жеребцов и маток не всегда имеет однонаправленный характер. В целом в течение последних десятилетий у жеребцов-производителей пяти заводских пород шел процесс снижения генетического разнообразия и элиминации редких аллелей. Это привело к тому, что в настоящее время у продуцирующих жеребцов верховых и рысистых пород (за исключением орловского рысака) преобладают одни и те же типы белков: TfFF, TfDF, EsII и аллели Ddk и Dcgm.

Современные методы изучения ДНК обусловили реальную возможность системного поиска генов и участков хромосом, определяющих скаковую работоспособность лошадей. Недавно было установлено, что на скаковую карьеру и дистанционные способности лошадей оказывает влияние структура гена миостатина (MSTN), локализованного в 18-й хромосоме.

Для лошадей уже разработаны генетические чипы, позволяющие одновременно проводить ДНК-типирование нескольких десятков важных генов, что создает реальную основу для внедрения методов маркерной селекции и геномной оценки в коневодстве.

Литература:

1. Дубровская, Р.М. Методические рекомендации по использованию полиморфных систем белков и групп крови при контроле достоверности происхождения лошадей [Текст]/Р.М.Дубровская / ВНИИ коневодства, 1986. - 39с.

2. Храброва, Л.А. Методические рекомендации по ведению генетического мониторинга местных пород лошадей [Текст] /Л.А. Храброва и др./ Дивово, 2005, - 50 С.

3. Храброва, Л.А. Руководство по использованию микросателлитов ДНК при генотипической оценке лошадей [Текст]/Л.А. Храброва, Н.В. Блохина/ Дивово, 2012, - 20с.

4. Храброва, Л.А. Метод оценки генетического разнообразия и степени генотипического сходства лошадей заводских и местных пород [Текст]/Л.А. Храброва и др. – Дивово, 2011. – 25 с.

УДК 638.12

ЗАВИСИМОСТЬ КАТАЛАЗНОЙ АКТИВНОСТИ РЕКТАЛЬНЫХ ЖЕЛЕЗ У МЕДОНОСНЫХ ПЧЕЛ
ОТ ДЛИНЫ И ВЕСА ПРЯМОЙ КИШКИ.


Н.М. Абдулгазина, А.Б. Сафаргалин, Ф.Г. Юмагужин

ФГБОУ ВПО Башкирский государственный агарный университет (Зауральский филиал), г. Сибай


Важнейшим признаком медоносных пчел в условиях продолжительной зимы является – зимостойкость. Зимостойкость – это сложное биологическое явление, определить которое по одному какому-нибудь значению невозможно. В связи с этим важным является установление косвенных значений зимостойкости пчел, по которым ее можно было бы прогнозировать. Следует отметить, что результаты зимовки пчел зависят от различных факторов: степени подготовленности пчел к зиме, качества корма, условий зимовки. Но в основном под зимостойкостью понимается способность пчел длительное время противодействовать гнилостным процессам в прямой кишке и не опонашиваться [1]. А это напрямую зависит от активности каталазы ректальных желез.

Каталаза - это фермент класса оксиредуктаз, катализирует разложение перекиси водорода до воды и кислорода, является одним из основных ферментов разрушения активных форм кислорода. Атомарный кислород, который получается при окислении перекиси водорода, препятствует развитию гнилостных микроорганизмов. Итак, активность каталазы ректальных желез является важным показателем интенсивности обмена веществ и является важным адаптационным механизмом зимостойкости медоносных пчел [2].

Нами рассматривались различия уровня активности каталазы ректальных желез от сезона года, связь активности каталазы с длиной прямой кишки, ее весом и значением кубитального индекса у местных медоносных пчел в горно-лесной и степной зонах Зауралья Республики Башкортостан. Сравнивали результаты с идентичными данными, полученными с бортевых пчелиных семей бурзянской популяции заповедника «Шульган-Таш» и заказника «Алтын Солок». Исследования проводились в 2009 – 2011 годах. Пробы пчел для анализа отбирали по 20-25 штук. В каждой группе исследовали по 20 пчелиных семей. Анализ активности фермента проводили перманганатометрическим методом, данные выражали в единицах мкмоль/мин/мг.

Зависимость активности каталазы ректальных желез от длины и веса прямой кишки в весенний период представлена в таблице 1. Длина и вес прямой кишки напрямую зависят от его наполненности каловыми массами. Из таблицы 1. видно, что с увеличением длины прямой кишки не происходит пропорциональное увеличение ее веса. К примеру, в 2009 году у пчелиных семей с бортей при длине прямой кишки 8,2 мм, вес ее составил 0,86 мг, 2010 году 8,45 мм и 0,39 мг, а 2011 году 7,65 мм и 0,63 мг, соответственно.


Таблица 1 Зависимость активности каталазы ректальных желез
от длины и веса прямой кишки (выборки пчел весенней генерации)


Годы

Выборки пчелиных семей

Длина прямой кишки, мм

Вес, мг

Активность каталазы

2009

бортевые

8,2

0,86

34,50

горно-лесные

8,17

0,29

48,13

степные

8,04

0,36

49,26

2010

бортевые

8,45

0,39

45,50

горно-лесные

8,05

0,44

47,63

степные

8,22

0,91

20,29

2011

бортевые

7,65

0,63

40,25

горно-лесные

8,05

0,31

49,50

степные

7,75

0,91

133,83

У пчелиных семей с рамочных ульев с горно-лесной зоны в 2009 году данные значения составили 8,17 мм и 0,29 мг, 2010 году – 8,05 мм и 0,44 мг, a 2011 – 8,05 мм и 0,31 мг, соответственно.

В выборках пчелиных семей со степной зоны также прямая зависимость длины прямой кишки от ее веса не проявляется. Если в 2009 году длина прямой кишки у медоносных пчел со степной зоны составил 8,04 мм, ее вес 0,36 мг, то 2010 году – 8,22 мм и 0,91 мг, а 2011 году – 7,75 мм и 0,91 мг, соответственно.

В то же время следует подчеркнуть, что активность каталазы ректальных желез медоносных пчел различной выборки в пределах Зауралья Республики Башкортостан зависит от веса и длины прямой кишки. При этом выявляется отрицательные соотношения данных параметров.

Наиболее информативно вышеизложенное мнение представлено на рисунках 1 и 2.

Рисунок 1 Соотношение активности каталазы ректальных желез


от длины прямой кишки (пчелы весенней генерации)
Из рисунка 1 видно, что наименьшей активности каталазы ректальных желез приходится наибольшая длина кишечника у всех выборок пчел весенней генерации по соответствующим годам и наоборот. Лишь у выборок пчел со степной зоны в 2011 году наблюдается отрицательная тенденция. Видимо, это связано с начинающимися процессами брожения в прямой кишке.

Как видно из рисунка 2 соотношение веса прямой кишки от каталазной активности ректальных желез также противоположное и наоборот. Это ярко видно у выборок медоносных пчел из бортей в 2009 году и со степной - в 2010 году. У выборок пчел с горно – лесной зоны зависимость сильно не проявляется. А у выборок пчел со степной зоны в 2011 году наибольшему весу прямой кишки соответствует высокая активность каталазы, что подтверждает мнение о процессах брожения, происходящих в прямой кишке.


Рисунок 2 Соотношение активности каталазы ректальных желез


от веса прямой кишки (пчелы весенней генерации)
Для медоносных пчел осенней генерации вышеизложенное утверждение остается также верным, то есть наблюдается зависимость каталазной активности ректальных желез от длины и веса прямой кишки или наполненности ее каловыми массами.

Таким образом, чем больше длина и вес прямой кишки, тем меньше каталазная активность ректальных желез и наоборот чем меньше длина и вес прямой кишки, тем больше активность данного фермента. То есть наполненность прямой кишки напрямую регулирует физиологические процессы выделения фермента каталазы.


Литература

  1. Лебедев, В.И. Биология пчелы медоносной и пчелиной семьи [Текст] / В.И. Лебедев, Н.Г. Билаш. – М.: КолосС, - 2006. – С. 232 – 234.

  2. Жеребкин М.В. Зимовка пчел [Текст] / М.В.Жеребкин. – М.: Россельхозиздат, 1979. – 151 с.

УДК 638.121.1



Новые технологии по замене пчелиных маток

Г.Г. Абдуллина, А.Н. Талипов, Ф.Г.Юмагужин

ФГБОУ ВПО Башкирский государтвенный аграрный университет (Зауральский филиал), г. Сибай


Пчеловодство – единственная отрасль животноводства, где нет ни одной заводской породы пчел, выведенной человеком. В практике используются естественные породы, сложившиеся под влиянием природно-климатических условий определенных зон. Они обладают огромным генетическим разнообразием показателей, характеризующих качество и продуктивность не только отдельных семей, но и пасек в целом.

В пчеловодстве низкая эффективность селекции пчел объясняется тем, что она основана на методах племенного отбора, аналогичных классическим методам селекции животных, рассчитанных на изменение индивидуальных свойств отдельных особей. При этом родительские пары имеют свою известную родословную, смена поколения растянута на несколько лет. Один производитель в животноводстве может использоваться несколько лет. В пчеловодстве эти методы не приемлемы. Трутни после спаривания погибают, оставляя после себя только одно поколение. За сезон от одной матки можно получить несколько поколений. Испытать полученное потомство можно в этом же году. Помесные матки не могут быть использованы, как надежный производитель, способный передать потомству все характерные для них хозяйственно полезные и биологические признаки. Результатом является большая разнородность семей на пасеке.

Если в середине прошлого века не было таких понятий, как «метизированные» или «генетически засоренные» пчелы, то в настоящее время в связи с постоянным завозом с юга пакетов пчелиных семей смешивание пород пчел стала обычным явлением. Данный процесс приобрел масштабный характер. Это привело к тому, что мы не имеем практически чистопородных пасек, в том числе в таком обширном регионе, как Башкирское Зауралье. В то же время в данном регионе есть все условия для отбора племенного материала и вывода племенных чистопородных маток. Для решения этой проблемы необходимо применении новой технологии по замене маток.

Безусловно, здесь есть свои нюансы, нужны чистопородные матки. Пакеты с чистопородными плодными матками приобретаем в заповеднике «Шульган-Таш», где сохранились чистопородные пчелы.

После весенней ревизии, выделяются все семьи, отстающие в развитии и занимающие от 2 до 4 рамок. Эти семьи надо утеплить, обеспечить достаточным количеством корма и оставить их в покое до получения первый партии молодых маток. Поэтапной замене подлежат все матки, которые не смогли обеспечить достаточное наращивание силы пчелиных семей. В семье воспитательнице, с наступлением благоприятных погодных условий приступаем выводу молодых маток. Первый этап замены проводим 15 - 20 мая на зрелый маточник. За три дня до выхода молодых маток, во всех отмеченных семьях уничтожаем старых маток. Вместо заложенных свищевых маточников поставляем маточники на выходе. Прием маточников почти 100%. Для страховки формируем несколько нуклеусов с запасными матками. После выхода и брачного облета молодые матки начинают работать. Эти семьи с молодыми матками быстро набирают силу, участвуют в медосборе с донника с середины июля и в августе.

Второй этап замены маток проводим в период роения. В семьях воспитательницах выводим вторую партию маток. После роения в основной семье убираем роевых маточников, даем молодую матку или маточник на выходе.

Третий этап замены маток проводим в конце июля по мере возможности. За пчеловодный сезон замене подлежат 70-75% маток. Только после начало откладки яиц молодыми матками, для подсиливание пчелосемьи рекомендуем дать расплод от сильных семей.

Благодаря последовательной поэтапной замене маток добились стабильности морфологических признаков. Кубитальный индекс на пасеках достиг 58,6%, а в отдельных семьях этот показатель составляет от 59,91% до 62,56%. Добились удовлетворительной зимовки пчелосемей. Доля слабых семей после зимовки составляет не более 10-12%, вместо 35%. Соответственно, через замены малопродуктивных маток идет селекция и одновременно создается трутневой фон из чистопородных трутней для следующего поколения молодых маток.


Литература:

  1. Буренин, Н.Л. Справочник по пчеловодству [Текст] / Н.Л. Буренин, Г.Н. Котова.- Краснодар: СОВЕТСКАЯ КУБАНЬ, 1988. –
    С. 89-91.

  2. Черевко, Ю.А. Учебник Пчеловодство [Текст]/ Ю.А.Черевко, Л.И.Бойценюк И.Ю. Верещака. - Москва: КолосС, - 2008. - С. 239-241: 247 -251.

УДК 636 .082.21

Анализ воспроизводства крупного рогатого скота симментальской породы Австрийской селекции ООО ПХ «Артемида»

следующая страница >>